Products
Online Inquiry
LipoKnoxa™ Human LDLR shRNA Ad5 Particle (Silencing)
Cat. No.:
V0525XX196
Species:
Human
Target Gene:
LDLR
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0525XX196-1 | GATGAAGTTGGCTGCGTTAAT | CDS | Inquiry |
| V0525XX196-2 | CCAGCGAAGATGCGAAGATAT | CDS | Inquiry |
| V0525XX196-3 | GAGTCACTGGTCACCCTTAAT | 3' UTR | Inquiry |
| V0525XX196-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human LDLR shRNA Ad5 Adenoviral Particle (Silencing) acts as a premier transcriptomic modulator targeting the Low Density Lipoprotein Receptor, the primary plasma membrane gateway that controls cholesterol clearance and systemic lipoprotein homeostasis from the systemic circulation. Silencing hepatic LDLR limits exogenous lipid uptake, driving a rapid rise in circulating plasma cholesterol and setting up an aggressive model to analyze lipid partitioning and lipotoxicity-induced cellular stress in high-fat diet environments. Our vector system can be customized with either standard U6 hairpins or miR30-based shRNA configurations to suit varied downstream experimental dynamics. Backed by thorough quality control monitoring—including detailed functional titer, sterility, and mycoplasma screenings—this viral particle provides researchers with the high safety profile needed for delicate lipid profiling.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
LDLR
Full Name:
Low density lipoprotein receptor
Gene Symbol:
LDLCQ2
Gene ID:
3949
RefSeq ID-1:
NP_000518.1
RefSeq ID-2:
NM_000527.5
Summary:
The LDLR gene encodes a cell-surface receptor that mediates the endocytosis of low-density lipoprotein (LDL) particles. Following internalization, cholesterol is released in lysosomes and contributes to feedback inhibition of HMG-CoA reductase, a key rate-limiting enzyme in cholesterol biosynthesis. This process is tightly linked to cellular lipid homeostasis, including the regulation of cholesterol uptake and esterification. Pathogenic variants in LDLR are a well-established cause of autosomal dominant familial hypercholesterolemia. Multiple transcript isoforms arise through alternative splicing.
Related Products
-
AdipoUpX™ Human EIF2S3 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human CALM2 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human DGAT1 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human ENPP1 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human BRD2 Ad5 Adenoviral Particle (Overexpression)
-
AdipoUpX™ Human PNLIPRP1 Ad5 Adenoviral Particle (Overexpression)