Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human KIF7 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX582
Species: Human
Target Gene: KIF7
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human KIF7 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX582-1 GGCCGTTACATGTGGATAAAC CDS Inquiry
V0126XX582-2 CCCTCACTGGGATCAACAAAT 3' UTR Inquiry
V0126XX582-3 AGCCCTCCTCTGCAAGTATTT CDS Inquiry
V0126XX582-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human KIF7 shRNA Lentiviral Particle (Silencing) is specifically developed for the stable inhibition of KIF7, a core regulator of the Sonic Hedgehog pathway involved in ciliary signaling and adipocyte development. Utilizing an advanced RNAi framework with a choice of U6 or miR30-based systems, researchers can evaluate the role of ciliary-mediated signaling in obesity. Every viral preparation is backed by comprehensive QC documentation confirming functional titer, sterility, and the absence of mycoplasma, ensuring high purity for sensitive cellular assays.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: KIF7
Full Name: Kinesin family member 7
Gene Symbol: ACLS; AGBK; HLS2; MMEDF; JBTS12; UNQ340
Gene ID: 374654
RefSeq ID-1: NP_940927.2
RefSeq ID-2: NM_198525.3
Summary: KIF7 encodes a cilia-associated kinesin protein that modulates the sonic hedgehog (SHH) pathway via GLI transcription factors. By influencing SHH signaling, KIF7 affects adipose tissue development and energy homeostasis. Mutations in KIF7 are associated with ciliopathies, some of which include obesity phenotypes.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.