Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human INPP5E shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX90
Species: Human
Target Gene: INPP5E
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human INPP5E shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX90-1 TCCGTTGGCAGCTGGCAAATT CDS Inquiry
V0525XX90-2 TCCTCCCATCATACAAGTTTG CDS Inquiry
V0525XX90-3 TGCTCCGTTTCTTGAAGTTTG CDS Inquiry
V0525XX90-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human INPP5E shRNA Ad5 Adenoviral Particle (Silencing) targets INPP5E, a primary ciliary 5-phosphatase that hydrolyzes phosphoinositides to maintain proper primary cilia signaling, which is critical for hypothalamic leptin-melanocortin pathways. Knockdown of INPP5E impairs leptin receptor trafficking, serving as a cornerstone model for studying central leptin resistance and ciliated neural control of appetite. To achieve precise knockdown, our platform utilizes premium Ad5 delivery of either short-hairpin U6 or native-like miR30-based shRNA systems. Thorough validation across premium quality control tiers—such as strict functional titration, sterility assays, and mycoplasma checks—guarantees outstanding experimental safety and data consistency for your metabolic and neuroscience studies.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: INPP5E
Full Name: Inositol polyphosphate-5-phosphatase E
Gene Symbol: CPD4; CORS1; JBTS1; MORMS; PPI5PIV; pharbin
Gene ID: 56623
RefSeq ID-1: NP_001305431.1
RefSeq ID-2: NM_001318502.1
Summary: INPP5E encodes an inositol polyphosphate-5-phosphatase that regulates phosphoinositide signaling by hydrolyzing inositol 1,4,5-trisphosphate and related lipid second messengers. The protein localizes to the Golgi and cytoplasmic compartments, where it modulates vesicular trafficking and intracellular signaling pathways. Mutations in INPP5E are associated with Joubert syndrome, a ciliopathy characterized by neurological and developmental abnormalities. Alternative splicing produces multiple transcript variants.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.