LipoKnoxa™ Human IGF1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX461-1	GAGTGCAGGAAACAAGAACTA	CDS	Inquiry
V0126XX461-2	GATTTCTTGAAGGTGAAGATG	CDS	Inquiry
V0126XX461-3	CACAAATGCATGGGTGTTGTA	3' UTR	Inquiry
V0126XX461-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IGF1 shRNA Lentiviral Particle (Silencing) targets IGF1 to study its pivotal role in growth, energy metabolism, and body composition. By offering high-potency U6-driven shRNA and physiologically refined miR30-based architectures, this lentiviral system provides a robust solution for long-term gene silencing. Each preparation is verified via thorough QC validation, including sequence integrity and microbial purity checks, to support stable integration in metabolic research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IGF1

Full Name: Insulin like growth factor 1

Gene Symbol: IGF; MGF; IGFI; IGF-I

Gene ID: 3479

RefSeq ID-1: NP_000609.1

RefSeq ID-2: NM_000618.5

Summary: IGF1 encodes a protein structurally and functionally similar to insulin and belongs to a family of proteins involved in growth and development. The protein is synthesized as a precursor, processed into its mature form, secreted, and binds to a specific receptor to exert its effects. Mutations in IGF1 cause insulin-like growth factor I deficiency. Alternative splicing generates multiple transcript variants encoding different isoforms, which may undergo similar processing to yield functional proteins.

LipoKnoxa™ Human IGF1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products