LipoKnoxa™ Human EIF2S3 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX526-1	ACTGTCCTGGCCACGATATTT	CDS	Inquiry
V0126XX526-2	GACTGAAGAATACCAGTTAAA	CDS	Inquiry
V0126XX526-3	GTAGGTAACGGTAAGGTTATT	3' UTR	Inquiry
V0126XX526-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human EIF2S3 shRNA Lentiviral Particle (Silencing) targets a subunit of the translation initiation factor eIF2, linked to metabolic dysfunction. Utilizing an advanced RNAi platform with optimized U6 or miR30-based shRNA delivery, this tool helps researchers understand protein translation control. To ensure the highest level of data reliability, every batch undergoes total QC verification—covering functional activity and sterility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: EIF2S3

Full Name: Eukaryotic translation initiation factor 2 subunit gamma

Gene Symbol: EIF2; EIF2G; MEHMO; eIF2gX; MRXSBRK; eIF-2gA; EIF2gamma

Gene ID: 1968

RefSeq ID-1: NP_001406.1

RefSeq ID-2: NM_001415.4

Summary: EIF2S3 encodes the largest component of the eIF2 complex, a heterotrimeric GTP-binding protein essential for protein synthesis. It plays a "gatekeeper" role by recruiting the initiator methionyl-tRNA to the ribosome. While fundamental to general cell biology, its role in protein translation makes it a factor in how cells respond to metabolic stress and growth signals, with mutations potentially impacting systemic development.

LipoKnoxa™ Human EIF2S3 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products