LipoKnoxa™ Human ITGAM shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX593-1	CAACTGTGATGGAGCAATTAA	CDS	Inquiry
V0126XX593-2	AGCGCTGCCATCACCTCTAAT	CDS	Inquiry
V0126XX593-3	GAAACTACAGTTGCCGAATTG	CDS	Inquiry
V0126XX593-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ITGAM shRNA Lentiviral Particle (Silencing) facilitates the persistent knockdown of CD11b, a marker for pro-inflammatory M1 macrophages that infiltrate adipose tissue. Utilizing both U6 and miR30-based shRNA systems, this product enables the study of immune-metabolic interactions in obesity. Every viral preparation is verified through thorough QC validation, including sequence integrity and microbial safety checks, providing a robust solution for researching chronic inflammation and insulin resistance.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ITGAM

Full Name: Integrin subunit alpha M

Gene Symbol: CR3A; MO1A; CD11B; MAC-1; MAC1A; SLEB6

Gene ID: 3684

RefSeq ID-1: NP_000623.2

RefSeq ID-2: NM_000632.4

Summary: ITGAM encodes the alpha M chain of the Mac-1 integrin, a critical receptor on the surface of white blood cells. This protein allows neutrophils and monocytes to adhere to the blood vessel walls and migrate toward sites of inflammation. In the context of metabolic health, ITGAM-positive cells are major players in the inflammatory infiltration of fat depots that occurs during weight gain.

LipoKnoxa™ Human ITGAM shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products