Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GNAT3 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX21
Species: Human
Target Gene: GNAT3
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GNAT3 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX21-1 CTCAACTGGCTGAGGTAATAA CDS Inquiry
V0525XX21-2 GACTACCCTTGGAATTGATTA CDS Inquiry
V0525XX21-3 ACCGTAAAGCTGCTACTATTA CDS Inquiry
V0525XX21-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GNAT3 shRNA Ad5 Adenoviral Particle (Silencing) serves as a specialized RNAi vector meticulously designed to knock down GNAT3 (α-gustducin), a key taste-bud-specific G-protein alpha subunit that is also functionally expressed in enteroendocrine cells of the gut. GNAT3 plays a critical role in sensing dietary sugars and lipids, thereby governing the secretion of metabolic satiety hormones like GLP-1 and PYY. Knocking down GNAT3 allows researchers to explore the gut-brain axis and taste-receptor signaling in the context of overeating and diet-induced obesity. This adenoviral platform supports flexible shRNA architectures, accommodating both high-potency U6 promoters and native-mimetic miR30-based systems. Backed by rigorous, comprehensive quality control screening—including rigorous functional titer, sterility, and mycoplasma testing—this product ensures outstanding safety and experimental reproducibility for metabolic research.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: GNAT3
Full Name: G protein subunit alpha transducin 3
Gene Symbol: GDCA; HG1E
Gene ID: 346562
RefSeq ID-1: NP_001095856.1
RefSeq ID-2: NM_001102386.3
Summary: GNAT3 encodes the α subunit of the heterotrimeric G protein that transmits sweet, bitter, and umami taste signals from taste receptors. Expression is not restricted to the oral epithelium; the protein is also detected in gastrointestinal tissues. Genetic variants in GNAT3 have been linked to metabolic syndrome traits.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.