LipoKnoxa™ Human EIF4EBP1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX25

Species: Human

Target Gene: EIF4EBP1

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human EIF4EBP1 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX25-1	GCGCAATAGCCCAGAAGATAA	CDS	Inquiry
V0525XX25-2	ACAGTTTGAGATGGACATTTA	CDS	Inquiry
V0525XX25-3	GCCAGGCCTTATGAAAGTGAT	3' UTR	Inquiry
V0525XX25-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human EIF4EBP1 shRNA Ad5 Adenoviral Particle (Silencing) enters the market as a premier transcriptomic modulator targeting 4E-BP1, a fundamental downstream effector of the mTORC1 pathway that restricts translational initiation of specific metabolic transcripts. Disruption of 4E-BP1 expression significantly influences adipogenesis, diet-induced obesity susceptibility, and skeletal muscle insulin action. To achieve optimal knockdown depth, this product allows for the precise utilization of high-titer Ad5-mediated delivery of either short-hairpin U6 or native-like miR30-based shRNA structures. Fully compatible with various reporter gene selections for seamless transduction tracking, each batch undergoes rigorous internal quality control, including functional titer, sterility, and mycoplasma testing, ensuring the highest standards of safety for lipid and protein synthesis research.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: EIF4EBP1

Full Name: Eukaryotic translation initiation factor 4E binding protein 1

Gene Symbol: BP-1; 4EBP1; 4E-BP1; PHAS-I

Gene ID: 1978

RefSeq ID-1: NP_004086.1

RefSeq ID-2: NM_004095.4

Summary: EIF4EBP1 encodes a translation repressor that binds the cap-binding factor eIF4E and blocks assembly of the eIF4F initiation complex. Phosphorylation of the protein in response to signals such as insulin or UV exposure releases eIF4E, thereby permitting cap-dependent mRNA translation and coupling extracellular cues to protein synthesis.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out