Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human CPE shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX522
Species: Human
Target Gene: CPE
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human CPE shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX522-1 ATGCAATATTCCTGGTATTAT 3' UTR Inquiry
V0126XX522-2 CTCCAGGCTATCTGGCAATAA CDS Inquiry
V0126XX522-3 TTCATTGGATTATGGATATTC CDS Inquiry
V0126XX522-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human CPE shRNA Lentiviral Particle (Silencing) targets carboxypeptidase E, which processes hormones like pro-insulin and pro-POMC. By offering both U6 and miR30-based shRNA systems, this tool assists in uncovering endocrine processing pathways. To ensure the highest level of biosafety, all products undergo total quality control screening for functional titer and pathogens.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CPE
Full Name: Carboxypeptidase E
Gene Symbol: CPH; BDVS; IDDHH
Gene ID: 1363
RefSeq ID-1: NP_001864.1
RefSeq ID-2: NM_001873.4
Summary: The CPE gene produces a multifunctional enzyme essential for the proteolytic processing of prohormones into their active states, including insulin and various neurotransmitters. Interestingly, it also functions as a sorting receptor within the secretory pathway and as a neurotrophic factor that supports neuronal health. Because it is vital for endocrine maturation, mutations in CPE are frequently associated with the onset of Type 2 diabetes and disrupted metabolic regulation.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.