LipoKnoxa™ Human COL18A1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX13

Species: Human

Target Gene: COL18A1

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human COL18A1 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX13-1	GCTGCCATACTTTCCTGTATA	3' UTR	Inquiry
V0525XX13-2	TTTACGACAGCAATGTGTTTG	CDS	Inquiry
V0525XX13-3	GAGATGCCAGCCTTGGATTTG	CDS	Inquiry
V0525XX13-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human COL18A1 shRNA Ad5 Adenoviral Particle (Silencing) targets Collagen Type XVIII, a major component of the extracellular matrix (ECM) whose cleavage product, endostatin, actively regulates adipose tissue angiogenesis and metabolic expansion. Knockdown of COL18A1 allows scientists to explore how remodeling the adipose ECM stromal fraction influences insulin sensitivity and fat pad vascularization. Available in multiple shRNA configurations, including U6-driven cassettes and physiological miR30-based frameworks, this product adapts seamlessly to your experimental design. Every single batch undergoes stringent internal quality control testing—incorporating precise functional titer, sterility, and mycoplasma assays—to provide unparalleled safety and experimental reproducibility.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: COL18A1

Full Name: Collagen type XVIII alpha 1 chain

Gene Symbol: KS; KNO; GLCC; KNO1

Gene ID: 80781

RefSeq ID-1: NP_001366429.1

RefSeq ID-2: NM_001379500.1

Summary: COL18A1 encodes the alpha chain of type XVIII collagen, an extracellular matrix component characterized by multiple collagenous and non-collagenous domains. Proteolytic cleavage of its C-terminal region generates endostatin, a potent inhibitor of angiogenesis and tumor growth. Mutations in COL18A1 cause Knobloch syndrome, and the protein is believed to contribute to retinal integrity as well as neural tube development.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out