LipoKnoxa™ Human BDNF shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX441

Species: Human

Target Gene: BDNF

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human BDNF shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX441-1	GTATGTACATTGACCATTAAA	CDS	Inquiry
V0126XX441-2	TTTCCTTACTATGGTTATTTC	CDS	Inquiry
V0126XX441-3	ACAGTGGTTCTACAATCTATT	3' UTR	Inquiry
V0126XX441-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BDNF shRNA Lentiviral Particle (Silencing) targets BDNF, which plays a pivotal role in suppressing food intake. Silencing BDNF through our dual-strategy shRNA platform (U6 and miR30) helps researchers model feeding behavior and neuroplasticity. We ensure a high-performing gene-silencing solution via thorough QC validation, including high-precision titer verification and negative results for sterility and mycoplasma.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BDNF

Full Name: Brain derived neurotrophic factor

Gene Symbol: ANON2; BULN2

Gene ID: 627

RefSeq ID-1: NP_001137277.1

RefSeq ID-2: NM_001143805.1

Summary: BDNF is a pivotal protein belonging to the nerve growth factor family. Synthesized as a preproprotein, it undergoes necessary proteolytic processing to yield the mature, bioactive form. In the adult brain, BDNF is crucial for promoting neuronal survival, plasticity, and differentiation by binding to its cognate receptor (TrkB). This neurotrophin plays a key modulatory role in the stress response and the underlying biology of mood disorders like depression. Pathologically, reduced BDNF expression is commonly observed in patients suffering from severe neurodegenerative conditions, including Alzheimer's, Parkinson's, and Huntington's disease.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out