LipoKnoxa™ Human ADCY3 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX443

Species: Human

Target Gene: ADCY3

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human ADCY3 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX443-1	AGAGTCCGCCCAAGTAGTAAA	CDS	Inquiry
V0126XX443-2	GCGTCCCGTCTTTGATGAATA	CDS	Inquiry
V0126XX443-3	ACCTAGAAGAGAAGGGTATTG	CDS	Inquiry
V0126XX443-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ADCY3 shRNA Lentiviral Particle (Silencing) provides a specialized solution for silencing ADCY3, which is critical for energy homeostasis and cilia function. Engineered with both U6 and miR30-based shRNA systems, this lentiviral tool enables the investigation of obesity-linked signal transduction. To ensure the highest level of biosafety, all products undergo total quality control screening, ensuring high functional titers and the absence of microbial contaminants.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ADCY3

Full Name: Adenylate cyclase 3

Gene Symbol: AC3; AC-III; BMIQ19

Gene ID: 109

RefSeq ID-1: NP_001307542.1

RefSeq ID-2: NM_001320613.1

Summary: ADCY3 encodes a membrane-associated enzyme that catalyzes the synthesis of the vital intracellular second messenger, cyclic adenosine monophosphate (cAMP), from ATP. This enzyme is widely distributed across various human tissues, including the brain and adipose tissue. Through its control over cAMP levels, ADCY3 is involved in numerous physiological and pathophysiological processes, including olfaction, neuronal function, and systemic metabolic regulation. Variations in this gene have been linked to appetite regulation and obesity susceptibility, highlighting its importance in metabolic signaling pathways.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out