LipoKnoxa™ Human ATP6V0D2 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX188

Species: Human

Target Gene: ATP6V0D2

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human ATP6V0D2 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX188-1	ACCTTGAGGCATTCTATAAAT	CDS	Inquiry
V0525XX188-2	TTACGAGCGTGAGGTACAAAT	CDS	Inquiry
V0525XX188-3	ATATCTTCATGAGTTGCAAAT	3' UTR	Inquiry
V0525XX188-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ATP6V0D2 shRNA Ad5 Adenoviral Particle (Silencing) offers an uncompromised loss-of-function approach for investigating ATP6V0D2, a vacuolar ATPase component highly induced during macrophage fusion and autophagosome-lysosome fusion within metabolic organs. Knockdown of ATP6V0D2 selectively disrupts chronic macrophage activation and blocks lipophagy cascades, offering essential insights into how lysosomal acidification failures dictate lipid droplet sequestration and insulin resistance under lipid overload. This recombinant virus supports highly flexible molecular architecture options, ranging from potent U6 hairpins to polycistronic miR30-based shRNA designs. Every specific production lot is fully certified by extensive quality control protocols, confirming ideal functional titer, absolute sterility, and negative mycoplasma status to safeguard your metabolic research outcomes.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: ATP6V0D2

Full Name: ATPase H+ transporting V0 subunit d2

Gene Symbol: VMA6; ATP6D2

Gene ID: 245972

RefSeq ID-1: NP_689778.1

RefSeq ID-2: NM_152565.1

Summary: ATP6V0D2 is a subunit of the V-type proton ATPase complex involved in ATP-driven proton transport. It contributes to intracellular acidification and vesicular trafficking and is primarily localized to membrane compartments associated with vacuolar function.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out