Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human AFF4 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX16
Species: Human
Target Gene: AFF4
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human AFF4 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX16-1 GCACGACCGTGAGTCATATAA CDS Inquiry
V0126XX16-2 CTCTCGGAAGAGGACTATTAG CDS Inquiry
V0126XX16-3 GTAAGAATTGGTTCGTCTAAA 3' UTR Inquiry
V0126XX16-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human AFF4 shRNA Ad5 Particle (Silencing) facilitates the specific knockdown of AFF4, a core component of the super elongation complex involved in adipogenic gene transcription. Using high-efficiency Ad5 delivery of U6-based shRNA, researchers can dissect the transcriptional elongation control of obesity-related genes. Each product is verified via comprehensive QC protocols, ensuring that functional activity and biological safety meet the highest laboratory standards.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: AFF4
Full Name: ALF transcription elongation factor 4
Gene Symbol: MCEF; CHOPS; AF5Q31
Gene ID: 27125
RefSeq ID-1: NP_055238.1
RefSeq ID-2: NM_014423.4
Summary: AFF4 encodes a transcription factor of the AF4 family, best known for its involvement in hematological malignancy. The AFF4 protein acts as an indispensable subunit of the Positive Transcription Elongation Factor b (P-TEFb) complex, which functions to greatly enhance the speed and efficiency of gene transcription. Its translocation is a defining feature of certain acute leukemias; specifically, a chromosomal rearrangement involving AFF4 and the MLL gene on chromosome 11 is a frequent finding in infant acute lymphoblastic leukemia cases involving specific insertions.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.