LipoKnoxa™ Human ACSL4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX574-1	GCAGTAGTTCATGGGCTAAAT	CDS	Inquiry
V0126XX574-2	GCCATGAAATTGGAGCGATTT	CDS	Inquiry
V0126XX574-3	CCTCAAAGACATTGAACGAAT	CDS	Inquiry
V0126XX574-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ACSL4 shRNA Lentiviral Particle (Silencing) targets ACSL4, which plays a critical role in fatty acid activation and the modulation of ferroptosis in metabolic tissues. Engineered via an advanced dual-platform (U6 and miR30-based shRNA), this lentiviral tool allows researchers to dissect the pathways of lipid partitioning and cellular stress in obesity. Our customizable system supports diverse promoter options and is backed by exhaustive quality control oversight, including high-precision titering and sterility verification, providing a secure and high-performing solution for long-term silencing studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ACSL4

Full Name: Acyl-CoA synthetase long chain family member 4

Gene Symbol: ACS4; FACL4; LACS4; MRX63; MRX68; XLID63

Gene ID: 2182

RefSeq ID-1: NP_001305438.1

RefSeq ID-2: NM_001318509.2

Summary: ACSL4 encodes a long-chain fatty-acid-CoA ligase that preferentially activates arachidonic acid. By converting free fatty acids into acyl-CoA esters, ACSL4 plays a key role in lipid synthesis and degradation, affecting adipocyte lipid storage and energy balance. Alternative splicing produces multiple transcript variants.

LipoKnoxa™ Human ACSL4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products