LipoKnoxa™ Human SLC27A1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX601-1	GTTCCTCTACTGGCCACAAAC	3' UTR	Inquiry
V0126XX601-2	GCCCTTAAATGAGGCAGTCTA	CDS	Inquiry
V0126XX601-3	CTCAGGTGACGTGCTAGTGAT	CDS	Inquiry
V0126XX601-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SLC27A1 shRNA Lentiviral Particle (Silencing) targets FATP1, the primary fatty acid transporter in skeletal muscle and adipose tissue. Silencing SLC27A1 through our dual-strategy shRNA platform (U6 and miR30) helps researchers model nutrient sensing and lipid-induced insulin resistance. Every viral preparation is backed by exhaustive QC documentation confirming sequence integrity and microbial safety, ensuring that gene knockdown remains stable and predictable across multiple cell passages.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SLC27A1

Full Name: Solute carrier family 27 member 1

Gene Symbol: FATP; FATP1; ACSVL5; FATP-1

Gene ID: 376497

RefSeq ID-1: NP_940982.1

RefSeq ID-2: NM_198580.3

Summary: SLC27A1 is a versatile transporter that manages the movement of long-chain fatty acids and biotin across plasma membranes. It is particularly important for the transport of lipids across the blood-brain barrier and into muscle and fat cells. Facilitating the uptake of these energy-rich molecules, it directly influences the fuel availability for various organ systems.

LipoKnoxa™ Human SLC27A1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products