Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human SIRT6 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX594
Species: Human
Target Gene: SIRT6
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human SIRT6 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX594-1 CTCCCTGGTCTCCAGCTTAAA 3' UTR Inquiry
V0126XX594-2 GAAGAATGTGCCAAGTGTAAG CDS Inquiry
V0126XX594-3 TGTCCATCACGCTGGGTACAT CDS Inquiry
V0126XX594-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human SIRT6 shRNA Lentiviral Particle (Silencing) provides an efficient tool for the stable suppression of sirtuin 6, a master regulator of glucose metabolism and DNA repair. Developed using optimized U6 and miR30-based shRNA systems, this tool helps researchers explore the acceleration of metabolic aging and steatosis. Each product is backed by exhaustive QC documentation, confirming functional titer, sequence integrity, and sterility, ensuring optimal performance for in vitro metabolic research.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SIRT6
Full Name: Sirtuin 6
Gene Symbol: SIR2L6; hSIRT6
Gene ID: 51548
RefSeq ID-1: NP_001180214.1
RefSeq ID-2: NM_001193285.3
Summary: SIRT6 is a "genomic guardian" from the sirtuin family that uses NAD to regulate aging, DNA repair, and telomere stability. Located in the nucleus, it acts as a master regulator of energy homeostasis by fine-tuning lipid and glucose metabolism. Its ability to combat inflammation and maintain chromatin integrity makes it a primary target for research into longevity and metabolic resilience.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.