LipoKnoxa™ Human SIM1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX434-1	TTGGCTCTCACCGGCAGTATT	CDS	Inquiry
V0126XX434-2	GCTTACACATTAACTGGATAT	CDS	Inquiry
V0126XX434-3	GTATCGTCAGCGTCAACTATG	CDS	Inquiry
V0126XX434-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SIM1 shRNA Lentiviral Particle (Silencing) targets the SIM1 transcription factor, which is essential for the development of paraventricular nucleus neurons and appetite control. Utilizing an advanced RNAi framework with a choice of U6 or miR30-based systems, researchers can evaluate the neuro-developmental drivers of obesity. Our lentiviral particles are screened through exhaustive QC screening—including functional titer, sterility, and mycoplasma checks—to ensure consistent performance.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SIM1

Full Name: SIM bHLH transcription factor 1

Gene Symbol: bHLHe14

Gene ID: 6492

RefSeq ID-1: NP_001361698.1

RefSeq ID-2: NM_001374769.1

Summary: SIM1 is the human homolog of the Drosophila single-minded (sim) gene. Although its expression profile is narrow, notably detected in the fetal kidney, its evolutionary role suggests a crucial function in neurogenesis and brain development. The SIM family plays vital roles in developmental patterning. Consequently, SIM1 is proposed as a strong candidate gene involved in specific dysmorphic features, brain development abnormalities, and cognitive impairments often associated with syndromes like Down Syndrome.

LipoKnoxa™ Human SIM1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products