LipoKnoxa™ Human IL6 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX449

Species: Human

Target Gene: IL6

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human IL6 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX449-1	ATGTGAAGCTGAGTTAATTTA	3' UTR	Inquiry
V0126XX449-2	ATGAGCGTTAGGACACTATTT	3' UTR	Inquiry
V0126XX449-3	GAGTACCTCCAGAACAGATTT	CDS	Inquiry
V0126XX449-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IL6 shRNA Lentiviral Particle (Silencing) targets Interleukin-6, a cytokine that mediates both metabolic regulation and inflammatory responses. To meet diverse experimental needs, we provide both U6-driven shRNA for maximum silencing and miR30-based shRNA for reduced toxicity in chronic inflammation models. Each viral preparation is subjected to total QC verification—covering functional titer, sterility, and mycoplasma—to ensure the highest standards of data reliability.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IL6

Full Name: Interleukin 6

Gene Symbol: CDF; HGF; HSF; BSF2; IL-6; BSF-2; IFNB2; IFN-beta-2

Gene ID: 3569

RefSeq ID-1: NP_000591.1

RefSeq ID-2: NM_000600.5

Summary: IL6 encodes a powerful cytokine that operates as an endogenous pyrogen and is a key mediator of the acute and chronic inflammatory response. Produced primarily at sites of inflammation, it is secreted into the serum and triggers a systemic transcriptional inflammatory response via the IL6 receptor (IL6R$\alpha$). IL6 is critical for the maturation of B cells and the induction of fever. Its dysregulation is implicated in a wide range of inflammation-associated diseases, including susceptibility to diabetes mellitus, systemic juvenile rheumatoid arthritis, and severe outcomes in viral infections like COVID-19 (due to SARS-CoV-2).

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out