LipoKnoxa™ Human PLIN1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX484-1	CGGGTTTCTCTAACAAATAAA	3' UTR	Inquiry
V0126XX484-2	GCCAGAGACACTGCGGAATTT	CDS	Inquiry
V0126XX484-3	ACCAACACCCTCTCTCGATAC	CDS	Inquiry
V0126XX484-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PLIN1 shRNA Lentiviral Particle (Silencing) targets PLIN1, which coats lipid droplets and regulates basal lipolysis. By utilizing optimized U6 and miR30-based shRNA delivery, this tool assists in uncovering the pathways of fat storage and mobilization. Each preparation is subjected to total QC verification—covering functional titer, sterility, and mycoplasma—to ensure the highest standards of biosafety and scientific soundness.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PLIN1

Full Name: Perilipin 1

Gene Symbol: PERI; PLIN; FPLD4

Gene ID: 5346

RefSeq ID-1: NP_001138783.1

RefSeq ID-2: NM_001145311.2

Summary: PLIN1 encodes perilipin 1, a protein that coats lipid droplets in adipocytes and regulates their breakdown. When unphosphorylated, it prevents lipolysis, while phosphorylation by cAMP-dependent protein kinase facilitates triglyceride hydrolysis. As the primary substrate for PKA in adipose tissue, PLIN1 plays a critical role in lipid storage and mobilization. Variants or dysregulation of this gene can contribute to abnormal fat accumulation and obesity.

LipoKnoxa™ Human PLIN1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products