LipoKnoxa™ Human APOB shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX469-1	CGCGGTCAACAACTATCATAA	CDS	Inquiry
V0126XX469-2	GAACTCAGAAGGATGGCATTT	3' UTR	Inquiry
V0126XX469-3	CGGAACTATCAACTCTACAAA	CDS	Inquiry
V0126XX469-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human APOB shRNA Lentiviral Particle (Silencing) targets Apolipoprotein B, the structural backbone of LDL and VLDL particles. By utilizing our dual-strategy platform (U6 and miR30 systems), researchers can explore the stable regulation of lipid transport and hepatic export. Every batch is validated through stringent QC processes, including functional titer measurement, sequence verification, and sterility testing, providing a secure technical foundation for cardiovascular research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: APOB

Full Name: Apolipoprotein B

Gene Symbol: FLDB; FCHL2; LDLCQ4; apoB-48; apoB-100

Gene ID: 338

RefSeq ID-1: NP_000375.3

RefSeq ID-2: NM_000384.3

Summary: APOB encodes the principal apolipoprotein of chylomicrons and low-density lipoproteins (LDL) and serves as the ligand for LDL receptors. It exists as two isoforms: apoB-48, produced in the gut, and apoB-100, produced in the liver. Both share a common N-terminal sequence, with apoB-48 generated via RNA editing of apoB-100 to introduce a stop codon. Mutations in APOB or its regulatory elements cause hypobetalipoproteinemia, normotriglyceridemic hypobetalipoproteinemia, and hypercholesterolemia, affecting plasma cholesterol and LDL levels.

LipoKnoxa™ Human APOB shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products