LipoKnoxa™ Human NFKB1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX554-1	CGAATGACAGAGGCGTGTATA	CDS	Inquiry
V0126XX554-2	GCCTGAACAAATGTTTCATTT	CDS	Inquiry
V0126XX554-3	CGCCTGAATCATTCTCGATTT	3' UTR	Inquiry
V0126XX554-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human NFKB1 shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of the p50 subunit to study inflammatory insulin resistance. Engineered with both high-potency U6 and physiologically refined miR30-based shRNA, this tool enables the study of chronic inflammation. Each preparation is backed by exhaustive QC documentation confirming sequence integrity and microbial safety.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: NFKB1

Full Name: Nuclear factor kappa B subunit 1

Gene Symbol: KBF1; EBP-1; NF-kB; CVID12; NF-kB1; NFKB-p50; NFkappaB; NF-kappaB; NFKB-p105; NF-kappa-B1; NF-kappabeta

Gene ID: 4790

RefSeq ID-1: NP_001158884.1

RefSeq ID-2: NM_001165412.2

Summary: NFKB1 produces a 105 kD precursor that is processed by the proteasome into the active p50 subunit of the NF-kappa-B complex. This transcription factor is a master regulator of the inflammatory response, activated by oxidative stress, cytokines, and pathogens. Dysregulated NF-kappa-B signaling is a hallmark of chronic metabolic inflammation, often bridging the gap between obesity and systemic insulin resistance.

LipoKnoxa™ Human NFKB1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products