Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GNAS shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX451
Species: Human
Target Gene: GNAS
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GNAS shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX451-1 TAAAGCCTTAAGCACAATTAA 3' UTR Inquiry
V0126XX451-2 CCTGCATGTTAATGGGTTTAA 3' UTR Inquiry
V0126XX451-3 TCACTACTGCTACCCTCATTT 3' UTR Inquiry
V0126XX451-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GNAS shRNA Lentiviral Particle (Silencing) is a precision-engineered tool for achieving stable knockdown of the G protein alpha subunit, a critical regulator of endocrine signaling and energy expenditure. Our platform utilizes two sophisticated expression strategies—high-potency U6-driven shRNA and physiologically refined miR30-based architectures—to allow researchers to model imprinting disorders and metabolic rate fluctuations. Every batch undergoes comprehensive quality control, including functional titer, sterility, and mycoplasma testing, ensuring that your long-term cell line studies are safe and highly reproducible.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: GNAS
Full Name: GNAS complex locus
Gene Symbol: AHO; GSA; GSP; POH; GPSA; NESP; SCG6; SgVI; GNAS1; PITA3; AIMAH1; C20orf45
Gene ID: 2778
RefSeq ID-1: NP_001070958.1
RefSeq ID-2: NM_001077490.3
Summary: GNAS is a highly complex imprinted locus that produces multiple transcripts expressed maternally, paternally, or biallelically. These transcripts arise from four alternative promoters and 5' exons, with some containing differentially methylated regions (DMRs) that influence gene expression. The locus also generates antisense noncoding RNAs, which may regulate imprinting, and one transcript includes an overlapping open reading frame encoding the unrelated protein Alex. Alternative splicing produces various forms of the stimulatory G-protein alpha subunit, a key mediator linking receptor-ligand interactions to adenylyl cyclase activation and downstream signaling. Multiple transcript variants encoding different isoforms have been identified. Mutations or imprinting defects in GNAS are linked to disorders such as pseudohypoparathyroidism types 1a/1b, Albright hereditary osteodystrophy, McCune-Albright syndrome, progressive osseous heteroplasia, polyostotic fibrous dysplasia, and some pituitary tumors. Importantly, defects in GNAS have also been associated with early-onset monogenic obesity, likely due to disrupted G-protein signaling in hypothalamic pathways that regulate energy balance and fat metabolism.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.