LipoKnoxa™ Human AGRP shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX447-1	AGCTGGGTACTGCCATGAATC	CDS	Inquiry
V0126XX447-2	ACAGGCAGAAGAGGATCTGTT	CDS	Inquiry
V0126XX447-3	GCCGCTTCTTCAATGCCTTCT	CDS	Inquiry
V0126XX447-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human AGRP shRNA Lentiviral Particle (Silencing) facilitates the long-term knockdown of AGRP, the primary hunger-stimulating neuropeptide. Engineered with both high-potency U6 and physiologically refined miR30-based shRNA, this tool allows researchers to model appetite regulation pathways. Each preparation is verified via thorough QC validation—including functional titer and mycoplasma testing—to ensure safety and reproducibility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: AGRP

Full Name: Agouti related neuropeptide

Gene Symbol: ART; AGRT; ASIP2

Gene ID: 181

RefSeq ID-1: NP_001129.1

RefSeq ID-2: NM_001138.2

Summary: AGRP encodes a potent neuropeptide that functions as a natural antagonist for the Melanocortin-3 and Melanocortin-4 receptors (MC3R and MC4R) in the hypothalamus. By blocking the binding of the satiety-promoting signal (alpha-MSH) to the MC4R, AGRP actively stimulates appetite and reduces energy expenditure. This powerful antagonism forms the key mechanism for hypothalamic control of feeding behavior and plays a central role in weight homeostasis. Gene mutations and copy number variations in AGRP have been clearly associated with late-onset obesity in humans.

LipoKnoxa™ Human AGRP shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products