LipoKnoxa™ Human AFF4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX436-1	GCACGACCGTGAGTCATATAA	CDS	Inquiry
V0126XX436-2	CTCTCGGAAGAGGACTATTAG	CDS	Inquiry
V0126XX436-3	GTAAGAATTGGTTCGTCTAAA	3' UTR	Inquiry
V0126XX436-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human AFF4 shRNA Lentiviral Particle (Silencing) enables the stable knockdown of the AFF4 scaffold protein to investigate its role in adipogenesis and transcriptional elongation. Our RNAi platform develops these tools with both U6 and miR30 systems to provide either maximal or regulated knockdown. Every preparation undergoes total QC verification—covering sequence identity and functional activity—to ensure that your experimental results are reproducible and safe.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: AFF4

Full Name: ALF transcription elongation factor 4

Gene Symbol: MCEF; CHOPS; AF5Q31

Gene ID: 27125

RefSeq ID-1: NP_055238.1

RefSeq ID-2: NM_014423.4

Summary: The protein encoded by AFF4 is a member of the AF4 family of transcription factors, recognized for its involvement in leukemogenesis. Crucially, AFF4 is an integral subunit of the Positive Transcription Elongation Factor b (P-TEFb) complex, which is responsible for regulating the elongation phase of gene transcription. Its function is often disrupted in cancer; specifically, chromosomal translocations involving AFF4 and the MLL gene on chromosome 11 are characteristic of certain aggressive forms of infant acute lymphoblastic leukemia.

LipoKnoxa™ Human AFF4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products