Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human AFF4 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX436
Species: Human
Target Gene: AFF4
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human AFF4 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX436-1 GCACGACCGTGAGTCATATAA CDS Inquiry
V0126XX436-2 CTCTCGGAAGAGGACTATTAG CDS Inquiry
V0126XX436-3 GTAAGAATTGGTTCGTCTAAA 3' UTR Inquiry
V0126XX436-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human AFF4 shRNA Lentiviral Particle (Silencing) enables the stable knockdown of the AFF4 scaffold protein to investigate its role in adipogenesis and transcriptional elongation. Our RNAi platform develops these tools with both U6 and miR30 systems to provide either maximal or regulated knockdown. Every preparation undergoes total QC verification—covering sequence identity and functional activity—to ensure that your experimental results are reproducible and safe.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: AFF4
Full Name: ALF transcription elongation factor 4
Gene Symbol: MCEF; CHOPS; AF5Q31
Gene ID: 27125
RefSeq ID-1: NP_055238.1
RefSeq ID-2: NM_014423.4
Summary: The protein encoded by AFF4 is a member of the AF4 family of transcription factors, recognized for its involvement in leukemogenesis. Crucially, AFF4 is an integral subunit of the Positive Transcription Elongation Factor b (P-TEFb) complex, which is responsible for regulating the elongation phase of gene transcription. Its function is often disrupted in cancer; specifically, chromosomal translocations involving AFF4 and the MLL gene on chromosome 11 are characteristic of certain aggressive forms of infant acute lymphoblastic leukemia.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.