Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human WNT10B shRNA AAV Particle (Silencing)

Cat. No.: V0126XX420
Species: Human
Target Gene: WNT10B
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human WNT10B shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX420-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-7 AAV3 Lung; Liver; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-8 AAV3 Lung; Liver; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-9 AAV3 Lung; Liver; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-10 AAV4 CNS; Retina; Heart; Lung; Kidney GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-11 AAV4 CNS; Retina; Heart; Lung; Kidney CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-12 AAV4 CNS; Retina; Heart; Lung; Kidney TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX420-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX420-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX420-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human WNT10B shRNA AAV Particle (Silencing) targets a signaling protein that acts as a potent inhibitor of adipogenesis. Silencing WNT10B through our dual-strategy shRNA platform (U6 and miR30) helps researchers model increased adiposity and the transition to obesity. Our platform offers a wide range of AAV serotypes for diverse in vivo applications. Every product is backed by comprehensive QC documentation, confirming sequence integrity and the total absence of pathogens (sterility and mycoplasma).
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: WNT10B
Full Name: Wnt family member 10B
Gene Symbol: SHFM6; STHAG8; WNT-12
Gene ID: 7480
RefSeq ID-1: NP_003385.2
RefSeq ID-2: NM_003394.3
Summary: WNT10B encodes a secreted signaling molecule of the WNT family that regulates cell fate determination and embryonic patterning. WNT10B signaling inhibits adipocyte differentiation and acts as a molecular switch governing adipogenesis. Dysregulation of this pathway can alter adipose tissue development and contribute to obesity. The protein shares high amino acid identity with mouse Wnt10b and is clustered with WNT1 on chromosome 12q13.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.