LipoKnoxa™ Human VPS13B shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX464-1	GCAAGTTGAGAGTAGTTATTA	CDS	Inquiry
V0126XX464-2	ATGGTACTCGCGCAGAATTTA	CDS	Inquiry
V0126XX464-3	ATCGTGCATTCATGGATATTT	CDS	Inquiry
V0126XX464-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human VPS13B shRNA Lentiviral Particle (Silencing) targets the gene associated with Cohen syndrome, which presents with truncal obesity and developmental delay. Silencing VPS13B through our dual-strategy shRNA platform (U6 and miR30) helps researchers model defects in intracellular trafficking. Each batch is validated through total quality control screening for functional titer, sequence integrity, and sterility, ensuring optimal reliability for long-term studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: VPS13B

Full Name: Vacuolar protein sorting 13 homolog B

Gene Symbol: CHS1; COH1; BLTP5B

Gene ID: 157680

RefSeq ID-1: NP_056058.2

RefSeq ID-2: NM_015243.2

Summary: VPS13B encodes a putative transmembrane protein that may function in vesicle-mediated protein transport and intracellular sorting. It is implicated in the development and function of the eye, hematological system, and central nervous system. Mutations in VPS13B cause Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified. Emerging evidence suggests that VPS13B dysfunction may contribute to obesity through altered cellular trafficking or metabolic regulation.

LipoKnoxa™ Human VPS13B shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products