Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human STAT1 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX406
Species: Human
Target Gene: STAT1
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human STAT1 shRNA AAV Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX406-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-7 AAV3 Lung; Liver; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-8 AAV3 Lung; Liver; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-9 AAV3 Lung; Liver; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-10 AAV4 CNS; Retina; Heart; Lung; Kidney CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-11 AAV4 CNS; Retina; Heart; Lung; Kidney CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-12 AAV4 CNS; Retina; Heart; Lung; Kidney CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CTGGAAGATTTACAAGATGAA CDS Inquiry
V0126XX406-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCCAAAGTATCAGGACGAGAA 3' UTR Inquiry
V0126XX406-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCCTGAAGTATCTGTATCCAA CDS Inquiry
V0126XX406-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human STAT1 shRNA AAV Particle (Silencing) targets STAT1, involved in IFN-gamma signaling and adipocyte dysfunction. Utilizing both high-potency U6 and physiologically refined miR30-based shRNA, this tool helps researchers study inflammatory gene expression in obesity. A diverse range of AAV serotypes is available for selection to achieve high-efficiency transduction. Each viral preparation is backed by comprehensive QC documentation, confirming functional titer and sequence integrity.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: STAT1
Full Name: Signal transducer and activator of transcription 1
Gene Symbol: CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91
Gene ID: 6772
RefSeq ID-1: NP_009330.1
RefSeq ID-2: NM_007315.4
Summary: STAT1 encodes a transcription factor belonging to the signal transducer and activator of transcription (STAT) family. Upon stimulation by cytokines or growth factors, including interferons, EGF, PDGF, and IL6, STAT1 is phosphorylated by receptor-associated kinases and forms dimers that translocate to the nucleus. There, it regulates gene expression involved in immune defense, stress responses, and cell survival. Chronic activation of STAT1-dependent inflammatory pathways has been linked to obesity-associated insulin resistance. Pathogenic variants in STAT1 cause Immunodeficiency 31A, 31B, and 31C, highlighting its essential role in host defense against viral, fungal, and mycobacterial infections.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.