Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human SLC16A1 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX131
Species:
Human
Target Gene:
SLC16A1
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX131-1 | TATGTTTCTGCTAGCTATATA | 3' UTR | Inquiry |
| V0126XX131-2 | CATGTGGCGTCGTCCTAATTA | CDS | Inquiry |
| V0126XX131-3 | GACCATGATTGGCAAGTATTT | CDS | Inquiry |
| V0126XX131-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human SLC16A1 shRNA Ad5 Particle (Silencing) is a high-efficiency RNAi tool designed to suppress the MCT1, which is essential for the transmembrane transport of pyruvate and lactate. By silencing SLC16A1 via our advanced U6 or miR30-based shRNA systems, researchers can explore the metabolic coupling between adipocytes and the surrounding environment, particularly in the context of lactic acid signaling and insulin secretion. Each batch is subjected to a comprehensive QC suite, including functional titer measurement, sequence integrity verification, and rigorous testing for sterility and mycoplasma to ensure optimal experimental reliability.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
SLC16A1
Full Name:
Solute carrier family 16 member 1
Gene Symbol:
MCT; HHF7; MCT1; MCT1D
Gene ID:
6566
RefSeq ID-1:
NP_001159968.1
RefSeq ID-2:
NM_001166496.2
Summary:
SLC16A1 encodes monocarboxylate transporter 1 (MCT1), a protein that facilitates the rapid movement of lactate and pyruvate across the plasma membrane using a proton-linked mechanism. By enabling the cellular exchange of these vital metabolites, it plays a critical role in the energy balance of glycolytic tissues. Mutations in this gene are clinically linked to erythrocyte lactate transporter defects, highlighting its importance in metabolic transport.
Related Products
-
AdipoUpX™ Human DGAT2 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human DYRK1B shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human TUB Ad5 Particle (Overexpression)
-
AdipoUpX™ Human IKBKB Ad5 Particle (Overexpression)
-
AdipoUpX™ Human FOXO1 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human PDE3B Ad5 Particle (Overexpression)