Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PRKAR1A shRNA AAV Particle (Silencing)

Cat. No.: V0126XX337
Species: Human
Target Gene: PRKAR1A
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PRKAR1A shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX337-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-7 AAV3 Lung; Liver; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-8 AAV3 Lung; Liver; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-9 AAV3 Lung; Liver; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-10 AAV4 CNS; Retina; Heart; Lung; Kidney GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-11 AAV4 CNS; Retina; Heart; Lung; Kidney GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-12 AAV4 CNS; Retina; Heart; Lung; Kidney CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCCTTATGTGTTACATTATTC 3' UTR Inquiry
V0126XX337-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCGCTGCTCAAAGATTCTATT CDS Inquiry
V0126XX337-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CATTGGAACCAGTGCAGTTTG CDS Inquiry
V0126XX337-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PRKAR1A shRNA AAV Particle (Silencing) targets the regulatory subunit of protein kinase A, involved in cAMP signaling and lipolysis. Suppressing this gene using our U6 or miR30 systems assists in uncovering the pathways of endocrine regulation in adipocytes and other cells. Our platform offers a wide spectrum of AAV serotypes to facilitate tissue-specific targeting. Every preparation undergoes total QC verification—covering functional activity and sequence identity—ensuring that results are scientifically sound.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: PRKAR1A
Full Name: Protein kinase cAMP-dependent type I regulatory subunit alpha
Gene Symbol: CAR; CNC; CNC1; PKR1; TSE1; ADOHR; PPNAD1; PRKAR1; ACRDYS1; Prkar1alpha
Gene ID: 5573
RefSeq ID-1: NP_001263218.1
RefSeq ID-2: NM_001276289.2
Summary: PRKAR1A encodes a regulatory subunit of cAMP-dependent protein kinase A (PKA), a central mediator of hormonal signaling. By controlling PKA activity, this protein influences pathways involved in energy metabolism, lipid mobilization, and endocrine regulation. Mutations in PRKAR1A disrupt cAMP signaling and can affect metabolic balance.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.