Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human MGLL shRNA AAV Particle (Silencing)
Cat. No.:
V0126XX393
Species:
Human
Target Gene:
MGLL
Vector System:
AAV
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | AAV Serotype | Tissue Tropism | TargetSeq | Region | Inquiry |
|---|---|---|---|---|---|
| V0126XX393-1 | AAV1 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-2 | AAV1 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-3 | AAV1 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-4 | AAV2 | CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-5 | AAV2 | CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-6 | AAV2 | CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-7 | AAV3 | Lung; Liver; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-8 | AAV3 | Lung; Liver; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-9 | AAV3 | Lung; Liver; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-10 | AAV4 | CNS; Retina; Heart; Lung; Kidney | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-11 | AAV4 | CNS; Retina; Heart; Lung; Kidney | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-12 | AAV4 | CNS; Retina; Heart; Lung; Kidney | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-13 | AAV5 | CNS; Brain; Retina; Heart; Lung; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-14 | AAV5 | CNS; Brain; Retina; Heart; Lung; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-15 | AAV5 | CNS; Brain; Retina; Heart; Lung; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-16 | AAV6 | Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-17 | AAV6 | Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-18 | AAV6 | Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-19 | AAV7 | CNS; Brain; Retina; Liver; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-20 | AAV7 | CNS; Brain; Retina; Liver; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-21 | AAV7 | CNS; Brain; Retina; Liver; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-22 | AAV8 | CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-23 | AAV8 | CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-24 | AAV8 | CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-25 | AAV9 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle | AGACACTGGACCTACCTTAAT | 3' UTR | Inquiry |
| V0126XX393-26 | AAV9 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle | CAACTCCGTCTTCCATGAAAT | CDS | Inquiry |
| V0126XX393-27 | AAV9 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle | CCAGGACAAGACTCTCAAGAT | CDS | Inquiry |
| V0126XX393-28 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human MGLL shRNA AAV Particle (Silencing) focuses on the inhibition of MGLL to study lipid signaling and the endocannabinoid system. By utilizing our dual-strategy platform (U6 and miR30 systems), researchers can evaluate the control of fatty acid release. Our system provides multiple AAV serotypes for tissue-specific tropism, supported by total quality control screening for functional titer and sequence integrity.
Production Cell Line:
HEK293
AAV ITR:
AAV2 ITR
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test:
Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test:
Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC:
Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage:
To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability:
Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition:
Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes:
To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.
Target Profile
Gene Name:
MGLL
Full Name:
Monoglyceride lipase
Gene Symbol:
MGL; HUK5; MAGL; HU-K5
Gene ID:
11343
RefSeq ID-1:
NP_001003794.1
RefSeq ID-2:
NM_001003794.3
Summary:
MGLL encodes monoacylglycerol lipase, an enzyme that hydrolyzes monoacylglycerides into free fatty acids and glycerol. By regulating lipid turnover and endocannabinoid signaling, MGLL affects appetite control, energy balance, and fat storage. Multiple alternatively spliced isoforms have been observed.