Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human MAPK14 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX230
Species: Human
Target Gene: MAPK14
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human MAPK14 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX230-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-7 AAV3 Lung; Liver; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-8 AAV3 Lung; Liver; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-9 AAV3 Lung; Liver; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-10 AAV4 CNS; Retina; Heart; Lung; Kidney GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-11 AAV4 CNS; Retina; Heart; Lung; Kidney CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-12 AAV4 CNS; Retina; Heart; Lung; Kidney CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GTACTTCCTGTGTACTCTTTA 3' UTR Inquiry
V0126XX230-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CTTCGGTTTCTGAGCATAATG 3' UTR Inquiry
V0126XX230-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCATGAGGCAAGAAACTATAT CDS Inquiry
V0126XX230-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human MAPK14 shRNA AAV Particle (Silencing) facilitates the specific knockdown of p38 alpha MAPK, a kinase involved in adipocyte thermogenesis and stress-induced insulin resistance. Utilizing an advanced RNAi platform with both U6 and miR30-based shRNA systems, researchers can evaluate the role of p38 in metabolic disease progression. A wide spectrum of AAV serotypes is available to ensure precise delivery. Every preparation is subjected to rigorous QC, including functional titer and mycoplasma testing, to guarantee the highest level of biosafety and reproducible results.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: MAPK14
Full Name: Mitogen-activated protein kinase 14
Gene Symbol: RK; p38; CSBP; EXIP; Mxi2; CSBP1; CSBP2; CSPB1; PRKM14; PRKM15; SAPK2A; p38ALPHA
Gene ID: 1432
RefSeq ID-1: NP_001306.1
RefSeq ID-2: NM_001315.3
Summary: The MAPK14 gene encodes a member of the MAP kinase family that plays a critical role in translating inflammatory and stress-related signals into cellular responses. MAPK14 is activated by environmental stress and pro-inflammatory cytokines via phosphorylation by MAP kinase kinases or through TAB1-dependent autophosphorylation. Its downstream targets include transcriptional regulators such as ATF2, MEF2C, and MAX, as well as CDC25B and p53, linking MAPK14 activity to stress-induced transcriptional regulation, cell cycle modulation, and DNA damage responses. The gene produces multiple isoforms through alternative splicing, enabling functional diversity in stress and metabolic signaling pathways.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.