Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human FFAR4 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX300
Species: Human
Target Gene: FFAR4
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human FFAR4 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX300-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-7 AAV3 Lung; Liver; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-8 AAV3 Lung; Liver; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-9 AAV3 Lung; Liver; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-10 AAV4 CNS; Retina; Heart; Lung; Kidney TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-11 AAV4 CNS; Retina; Heart; Lung; Kidney CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-12 AAV4 CNS; Retina; Heart; Lung; Kidney CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX300-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX300-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX300-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human FFAR4 shRNA AAV Particle (Silencing) targets GPR120, a receptor for omega-3 fatty acids that mediates anti-inflammatory effects. By utilizing a choice between high-potency U6-driven shRNA and physiologically optimized miR30 architectures, researchers can study the role of fatty acid sensing in metabolic health. This product supports a wide range of AAV serotypes for diverse in vivo applications. Every batch is validated through stringent QC processes, including functional titer measurement and sequence verification.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: FFAR4
Full Name: Free fatty acid receptor 4
Gene Symbol: GT01; PGR4; OB10Q; BMIQ10; GPR120; GPR129; O3FAR1
Gene ID: 338557
RefSeq ID-1: NP_001182684.1
RefSeq ID-2: NM_001195755.2
Summary: FFAR4 encodes a G protein-coupled receptor that acts as a sensor for long-chain omega-3 fatty acids. Upon activation, it triggers insulin-sensitizing and anti-inflammatory responses, particularly in adipose tissue. By suppressing the chronic low-grade inflammation often associated with obesity, FFAR4 serves as a protective metabolic factor and a key therapeutic target for treating insulin resistance.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.