LipoKnoxa™ Human IRX3 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX123

Species: Human

Target Gene: IRX3

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human IRX3 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX123-1	GTTTGTTTGTCCGGTTGATTT	3' UTR	Inquiry
V0126XX123-2	TTGTAAGCATGTCCGTGTATA	3' UTR	Inquiry
V0126XX123-3	GCGCCTCAAGAAGGAGAATAA	CDS	Inquiry
V0126XX123-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IRX3 shRNA Ad5 Particle (Silencing) targets the iroquois homeobox 3 gene, a major functional link between FTO risk variants and obesity. By silencing IRX3 through optimized shRNA systems, researchers can evaluate the browning potential of white adipocytes and thermogenic capacity. Each viral preparation is subjected to total QC verification—covering sequence identity and functional activity—to ensure that your experimental results are scientifically sound.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: IRX3

Full Name: Iroquois homeobox 3

Gene Symbol: IRX-1; IRXB1

Gene ID: 79191

RefSeq ID-1: NP_077312.2

RefSeq ID-2: NM_024336.3

Summary: IRX3 is a homeobox gene originally known for its role in early neural development. However, recent genome-wide studies have linked it to the regulation of body mass. It appears to influence the metabolic program of adipocyte progenitors, determining whether energy is stored or dissipated as heat.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out