Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human FBP1 shRNA AAV Particle (Silencing)
Cat. No.:
V0126XX352
Species:
Human
Target Gene:
FBP1
Vector System:
AAV
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | AAV Serotype | Tissue Tropism | TargetSeq | Region | Inquiry |
|---|---|---|---|---|---|
| V0126XX352-1 | AAV1 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-2 | AAV1 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-3 | AAV1 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-4 | AAV2 | CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-5 | AAV2 | CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-6 | AAV2 | CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-7 | AAV3 | Lung; Liver; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-8 | AAV3 | Lung; Liver; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-9 | AAV3 | Lung; Liver; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-10 | AAV4 | CNS; Retina; Heart; Lung; Kidney | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-11 | AAV4 | CNS; Retina; Heart; Lung; Kidney | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-12 | AAV4 | CNS; Retina; Heart; Lung; Kidney | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-13 | AAV5 | CNS; Brain; Retina; Heart; Lung; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-14 | AAV5 | CNS; Brain; Retina; Heart; Lung; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-15 | AAV5 | CNS; Brain; Retina; Heart; Lung; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-16 | AAV6 | Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-17 | AAV6 | Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-18 | AAV6 | Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-19 | AAV7 | CNS; Brain; Retina; Liver; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-20 | AAV7 | CNS; Brain; Retina; Liver; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-21 | AAV7 | CNS; Brain; Retina; Liver; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-22 | AAV8 | CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-23 | AAV8 | CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-24 | AAV8 | CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-25 | AAV9 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle | CCCAGATAATTCAGCTCCTTA | CDS | Inquiry |
| V0126XX352-26 | AAV9 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle | CGACCTGGTTATGAACATGTT | CDS | Inquiry |
| V0126XX352-27 | AAV9 | CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle | CAGCAGTCAAAGCCATCTCTT | CDS | Inquiry |
| V0126XX352-28 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human FBP1 shRNA AAV Particle (Silencing) focuses on the targeted inhibition of FBP1, a rate-limiting enzyme in gluconeogenesis. By utilizing our advanced RNAi platform with a choice of U6 or miR30-based systems, researchers can evaluate the role of hepatic glucose production. A wide spectrum of AAV serotypes is available to ensure precise delivery. Every preparation is subjected to rigorous QC, including functional titer and mycoplasma testing, providing a secure and high-performing gene-silencing solution.
Production Cell Line:
HEK293
AAV ITR:
AAV2 ITR
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test:
Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test:
Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC:
Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage:
To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability:
Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition:
Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes:
To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.
Target Profile
Gene Name:
FBP1
Full Name:
Fructose-bisphosphatase 1
Gene Symbol:
FBP
Gene ID:
2203
RefSeq ID-1:
NP_000498.2
RefSeq ID-2:
NM_000507.3
Summary:
FBP1 encodes fructose-1,6-bisphosphatase, a rate-limiting enzyme in gluconeogenesis that converts fructose-1,6-bisphosphate to fructose-6-phosphate. Proper regulation of FBP1 is essential for glucose homeostasis, and deficiencies in this enzyme are associated with hypoglycemia and metabolic acidosis.
Related Products
-
AdipoUpX™ Human SH2B1 AAV Particle (Overexpression)
-
LipoKnoxa™ Human ACOT11 shRNA AAV Particle (Silencing)
-
LipoKnoxa™ Human FFAR4 shRNA AAV Particle (Silencing)
-
LipoKnoxa™ Human IRX3 shRNA AAV Particle (Silencing)
-
AdipoUpX™ Human OPA1 AAV Particle (Overexpression)
-
LipoKnoxa™ Human DGAT1 shRNA AAV Particle (Silencing)