Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human FAS shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX617
Species: Human
Target Gene: FAS
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human FAS shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX617-1 CCCTTGTGTTTGGAATTATAA 3' UTR Inquiry
V0126XX617-2 GCGTATGACACATTGATTAAA CDS Inquiry
V0126XX617-3 CCTGAAACAGTGGCAATAAAT CDS Inquiry
V0126XX617-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human FAS shRNA Lentiviral Particle (Silencing) provides a robust system for the stable knockdown of the Fas receptor (CD95) to study the link between cell death signaling and insulin resistance. This tool is developed using both U6 and miR30-based shRNA systems to accommodate various experimental silencing needs in metabolic tissues. Every preparation is verified via thorough QC validation—including functional activity and microbial purity checks—to ensure optimal reliability and experimental reproducibility.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FAS
Full Name: Fas cell surface death receptor
Gene Symbol: APT1; CD95; FAS1; APO-1; FASTM; ALPS1A; TNFRSF6
Gene ID: 355
RefSeq ID-1: NP_000034.1
RefSeq ID-2: NM_000043.6
Summary: FAS encodes a death receptor belonging to the TNF receptor superfamily and contains a cytoplasmic death domain essential for apoptosis signaling. Ligand binding triggers formation of the death-inducing signaling complex (DISC), involving FADD, caspase-8, and caspase-10, ultimately activating downstream caspase cascades. Beyond apoptosis, FAS signaling can activate NF-κB, ERK1, and JNK pathways, influencing cell proliferation. In obesity, dysregulated FAS-mediated apoptosis in adipocytes and immune cells contributes to adipose tissue remodeling, inflammation, and metabolic dysfunction. Multiple alternatively spliced transcript variants exist, including soluble isoforms that may inhibit apoptosis.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.