Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human FABP5 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX202
Species:
Human
Target Gene:
FABP5
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX202-1 | CTTTGGACAGGAGTTAATTAA | 3' UTR | Inquiry |
| V0126XX202-2 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human GFRAL shRNA Ad5 Particle (Silencing) targets the brainstem-restricted receptor for GDF15, which is essential for mediating the anorexigenic and weight-reducing effects of GDF15. Silencing GFRAL via high-efficiency shRNA (U6 or miR30-based) assists in uncovering the neuronal pathways governing food aversion and metabolic adaptation during stress. We provide a fully validated product through comprehensive quality control, ensuring sequence integrity, functional titer, and sterility for consistent performance in neuro-metabolic research.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
FABP5
Full Name:
Fatty acid binding protein 5
Gene Symbol:
EFABP; KFABP; E-FABP; PAFABP; PA-FABP
Gene ID:
2171
RefSeq ID-1:
NP_001435.1
RefSeq ID-2:
NM_001444.3
Summary:
FABP5 encodes a fatty acid–binding protein originally identified in epidermal cells and upregulated in psoriatic lesions. Like other members of the FABP family, it binds long-chain fatty acids and hydrophobic ligands, facilitating their intracellular transport and metabolism. FABP5 has emerged as an important regulator of lipid signaling in adipocytes and immune cells, linking it to obesity, insulin resistance, and type 2 diabetes. Numerous FABP5-related pseudogenes are present in the human genome.
Related Products
-
AdipoUpX™ Human EIF2S3 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human MYT1L Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human SLC6A14 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human CRP Ad5 Particle (Overexpression)
-
AdipoUpX™ Human EIF2AK3 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human MC4R Ad5 Particle (Overexpression)