Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human ACACB shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX139
Species:
Human
Target Gene:
ACACB
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX139-1 | ACCTCGTAGATGTGGAATTAA | CDS | Inquiry |
| V0126XX139-2 | CCCGAGAACCTCAAGAAATTA | CDS | Inquiry |
| V0126XX139-3 | TGTCCATCCGAGGCGACTTTA | CDS | Inquiry |
| V0126XX139-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human ACACB shRNA Ad5 Particle (Silencing) targets acetyl-CoA carboxylase beta, the enzyme that regulates fatty acid oxidation by controlling malonyl-CoA levels at the mitochondrial membrane. Precise knockdown of ACACB via our advanced RNAi platform allows for the investigation of therapeutic strategies to enhance fat burning. Our quality system ensures viral potency and sterility, providing a reliable technical foundation through validated shRNA systems and total QC oversight.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
ACACB
Full Name:
Acetyl-CoA carboxylase beta
Gene Symbol:
ACC2; ACCB; ACCbeta; HACC275; ACACbeta; ACC-beta
Gene ID:
32
RefSeq ID-1:
NP_001084.3
RefSeq ID-2:
NM_001093.4
Summary:
ACACB encodes Acetyl-CoA carboxylase beta, a key enzyme located on the outer mitochondrial membrane. It catalyzes the production of malonyl-CoA, which acts as a potent inhibitor of fatty acid entry into the mitochondria for oxidation. By regulating the transition between fat synthesis and fat burning, ACACB is a major determinant of whole-body lipid utilization efficiency.
Related Products
-
AdipoUpX™ Human ADRB2 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human NR3C1 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human SIM1 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human RPGRIP1L shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human CEP19 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human FTO Ad5 Particle (Overexpression)