Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human SIM1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX14
Species: Human
Target Gene: SIM1
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human SIM1 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX14-1 TTGGCTCTCACCGGCAGTATT CDS Inquiry
V0126XX14-2 GCTTACACATTAACTGGATAT CDS Inquiry
V0126XX14-3 GTATCGTCAGCGTCAACTATG CDS Inquiry
V0126XX14-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human SIM1 shRNA Ad5 Particle (Silencing) targets the SIM1 gene, a transcription factor essential for the development of the paraventricular nucleus in the hypothalamus. By achieving efficient gene silencing through specialized shRNA architectures, this tool is ideal for researching the neurobiological basis of hyperphagic obesity. We guarantee optimal reliability by conducting thorough QC on functional titers, sequence identity, and sterility for every preparation.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: SIM1
Full Name: SIM bHLH transcription factor 1
Gene Symbol: bHLHe14
Gene ID: 6492
RefSeq ID-1: NP_001361698.1
RefSeq ID-2: NM_001374769.1
Summary: SIM1 is one of two human homologs of the key Drosophila developmental gene, single-minded (sim). While its detectable expression is highly restricted in adult tissues, its role is proposed to be fundamental during neurogenesis and embryonic development. The SIM family's developmental importance suggests that human SIM1 is a critical factor in regulating brain architecture and potentially predisposing individuals to specific dysmorphic facial and skull characteristics and cognitive disability, often within the context of Down syndrome features.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.