LipoKnoxa™ Human PPARD shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX116

Species: Human

Target Gene: PPARD

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human PPARD shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX116-1	CCGCAAACCCTTCAGTGATAT	CDS	Inquiry
V0126XX116-2	TATTCATTGCGGCCATCATTC	CDS	Inquiry
V0126XX116-3	ATCCACGACATCGAGACATTG	CDS	Inquiry
V0126XX116-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PPARD shRNA Ad5 Particle (Silencing) is designed to silence v, a major regulator of fatty acid catabolism in skeletal muscle and adipose tissue. Utilizing an advanced RNAi platform, this product facilitates the study of energy expenditure and endurance metabolism. The system undergoes exhaustive quality control—including functional titer, sequence verification, and mycoplasma detection—to guarantee the highest level of biosafety and data reproducibility.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: PPARD

Full Name: Peroxisome proliferator activated receptor delta

Gene Symbol: FAAR; NUC1; NUCI; NR1C2; NUCII; PPARB

Gene ID: 5467

RefSeq ID-1: NP_001165289.1

RefSeq ID-2: NM_001171818.2

Summary: PPARD is a nuclear receptor that integrates transcriptional repression and metabolic signaling. It is thought to modulate the activity of other PPARs (alpha and gamma). Studies suggest it plays a key role in lipid metabolism, skin cell proliferation, and the myelination of nerves, making it a complex regulator of both development and energy flux.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out