Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PLIN1 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX274
Species: Human
Target Gene: PLIN1
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PLIN1 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX274-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-7 AAV3 Lung; Liver; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-8 AAV3 Lung; Liver; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-9 AAV3 Lung; Liver; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-10 AAV4 CNS; Retina; Heart; Lung; Kidney CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-11 AAV4 CNS; Retina; Heart; Lung; Kidney GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-12 AAV4 CNS; Retina; Heart; Lung; Kidney ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGGGTTTCTCTAACAAATAAA 3' UTR Inquiry
V0126XX274-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCCAGAGACACTGCGGAATTT CDS Inquiry
V0126XX274-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle ACCAACACCCTCTCTCGATAC CDS Inquiry
V0126XX274-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PLIN1 shRNA AAV Particle (Silencing) focuses on the inhibition of perilipin 1, the protein that coats and protects lipid droplets in adipocytes. Silencing this gene using our U6 or miR30 systems assists in uncovering the pathways of basal and stimulated lipolysis. Multiple AAV serotypes are provided for adipose-specific targeting, and each viral preparation is subjected to total QC verification—covering functional activity and sequence identity.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: PLIN1
Full Name: Perilipin 1
Gene Symbol: PERI; PLIN; FPLD4
Gene ID: 5346
RefSeq ID-1: NP_001138783.1
RefSeq ID-2: NM_001145311.2
Summary: PLIN1 encodes a protective protein that coats the surface of lipid droplets within adipocytes. Its primary function is to act as a physical barrier, "guarding" stored fats from premature breakdown by enzymes like hormone-sensitive lipase. In its resting state, PLIN1 inhibits lipolysis (the breakdown of fats); however, when metabolic demand increases, it becomes phosphorylated, allowing lipases access to the lipid core. Because it directly controls the mobilization of fat stores, PLIN1 is a critical factor in the regulation of body fat percentage and systemic energy availability.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.