LipoKnoxa™ Human MGLL shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX603-1	AGACACTGGACCTACCTTAAT	3' UTR	Inquiry
V0126XX603-2	CAACTCCGTCTTCCATGAAAT	CDS	Inquiry
V0126XX603-3	CCAGGACAAGACTCTCAAGAT	CDS	Inquiry
V0126XX603-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MGLL shRNA Lentiviral Particle (Silencing) targets MGLL, the primary enzyme in the degradation of the endocannabinoid 2-AG and a contributor to fatty acid release. Our RNAi platform develops this product with both U6 and miR30 systems to investigate lipid signaling and inflammation. Every product is backed by comprehensive QC documentation, confirming functional titer, sequence identity, and sterility, providing a secure and reliable tool for metabolic research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MGLL

Full Name: Monoglyceride lipase

Gene Symbol: MGL; HUK5; MAGL; HU-K5

Gene ID: 11343

RefSeq ID-1: NP_001003794.1

RefSeq ID-2: NM_001003794.3

Summary: MGLL encodes the enzyme responsible for breaking down monoacylglycerols into free fatty acids and glycerol. It is a dual-purpose regulator: it provides energy by mobilizing stored fats and also terminates signaling by the endocannabinoid 2-arachidonoylglycerol. This gives MGLL a unique role in linking fat metabolism to the regulation of pain and appetite.

LipoKnoxa™ Human MGLL shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products