Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human IGF1 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX251
Species: Human
Target Gene: IGF1
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human IGF1 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX251-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-7 AAV3 Lung; Liver; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-8 AAV3 Lung; Liver; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-9 AAV3 Lung; Liver; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-10 AAV4 CNS; Retina; Heart; Lung; Kidney GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-11 AAV4 CNS; Retina; Heart; Lung; Kidney GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-12 AAV4 CNS; Retina; Heart; Lung; Kidney CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GAGTGCAGGAAACAAGAACTA CDS Inquiry
V0126XX251-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GATTTCTTGAAGGTGAAGATG CDS Inquiry
V0126XX251-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CACAAATGCATGGGTGTTGTA 3' UTR Inquiry
V0126XX251-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human IGF1 shRNA AAV Particle (Silencing) facilitates the targeted inhibition of IGF1, a central hormone for growth and glucose metabolism. Engineered with both high-potency U6 and physiologically refined miR30-based shRNA, this tool allows researchers to model the impact of reduced IGF-1 signaling on body composition. Multiple AAV serotypes are available to ensure precise delivery. To ensure experimental success, every batch undergoes total quality control screening for sequence accuracy and functional titer.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: IGF1
Full Name: Insulin like growth factor 1
Gene Symbol: IGF; MGF; IGFI; IGF-I
Gene ID: 3479
RefSeq ID-1: NP_000609.1
RefSeq ID-2: NM_000618.5
Summary: IGF1 encodes a polypeptide hormone structurally similar to insulin, serving as a primary mediator of growth and development throughout the body. The active protein is derived from a precursor and secreted to bind to its specific receptor, activating a crucial signaling cascade. This pathway controls cell proliferation, differentiation, and survival, directly impacting tissue growth and glucose metabolism. While defects primarily result in Insulin-Like Growth Factor I deficiency syndromes, IGF1 signaling is intimately linked to the regulation of body composition and energy balance, influencing fat and muscle mass. The gene uses alternative splicing to produce various isoforms that maintain similar biological activity.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.