Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GPX1 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX351
Species: Human
Target Gene: GPX1
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GPX1 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX351-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-7 AAV3 Lung; Liver; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-8 AAV3 Lung; Liver; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-9 AAV3 Lung; Liver; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-10 AAV4 CNS; Retina; Heart; Lung; Kidney CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-11 AAV4 CNS; Retina; Heart; Lung; Kidney CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-12 AAV4 CNS; Retina; Heart; Lung; Kidney GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCGCTTCCAGACCATTGACAT CDS Inquiry
V0126XX351-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CAAGAACGAAGAGATTCTGAA CDS Inquiry
V0126XX351-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCATCAGGAGAACGCCAAGAA CDS Inquiry
V0126XX351-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GPX1 shRNA AAV Particle (Silencing) targets GPX1, an antioxidant enzyme that influences the cellular redox state and insulin signaling. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool enables the study of oxidative stress in metabolic disease. Multiple AAV serotypes are available to ensure precise delivery. Every preparation is verified via thorough QC validation, including sequence integrity and sterility testing, ensuring optimal reliability.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: GPX1
Full Name: Glutathione peroxidase 1
Gene Symbol: GPXD; GSHPX1
Gene ID: 2876
RefSeq ID-1: NP_000572.2
RefSeq ID-2: NM_000581.3
Summary: GPX1 encodes a cytosolic glutathione peroxidase that protects cells from oxidative damage by reducing hydrogen peroxide and organic hydroperoxides. Beyond antioxidant defense, GPX1 influences redox-sensitive signaling pathways involved in mitochondrial function and metabolic regulation. This enzyme is a selenoprotein and is ubiquitously expressed, with several transcript variants and known genetic polymorphisms.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.