Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GHRL shRNA AAV Particle (Silencing)

Cat. No.: V0126XX218
Species: Human
Target Gene: GHRL
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GHRL shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX218-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-7 AAV3 Lung; Liver; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-8 AAV3 Lung; Liver; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-9 AAV3 Lung; Liver; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-10 AAV4 CNS; Retina; Heart; Lung; Kidney GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-11 AAV4 CNS; Retina; Heart; Lung; Kidney ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-12 AAV4 CNS; Retina; Heart; Lung; Kidney GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCAGAGAAAGGAGTCGAAGAA CDS Inquiry
V0126XX218-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle ACCAGAGAGTCCAGCAGAGAA CDS Inquiry
V0126XX218-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GGAAGTTTCTTCAGGACATCC CDS Inquiry
V0126XX218-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GHRL shRNA AAV Particle (Silencing) is a precision tool for knocking down the ghrelin gene, a key initiator of hunger signals. Utilizing an advanced RNAi framework that includes both U6 and miR30-based shRNA systems, researchers can effectively study the gut-brain axis in appetite regulation. Our platform offers a wide range of AAV serotypes (including AAV8, AAV9, etc.) to ensure high-efficiency transduction in target organs. Each batch is subjected to rigorous QC—including functional titer, sterility, and sequence integrity—to maintain the highest level of biosafety and data reliability.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: GHRL
Full Name: Ghrelin and obestatin prepropeptide
Gene Symbol: MTLRP
Gene ID: 51738
RefSeq ID-1: NP_001128413.1
RefSeq ID-2: NM_001134941.3
Summary: The GHRL gene encodes a large precursor protein that undergoes specific proteolytic processing to generate ghrelin and obestatin. As a “hunger” signal, ghrelin is secreted from the stomach during fasting. Circulating through the bloodstream, it targets the ghrelin receptor in the hypothalamus, activating neural pathways to powerfully stimulate appetite and promote growth hormone release. Its functions are extensive, involving cross-system regulation from gastrointestinal motility to reward systems. Although the function of obestatin remains controversial, it may act as an antagonist to ghrelin, participating in metabolic regulation of insulin and adipocyte function.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.