Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human BBS10 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX46
Species: Human
Target Gene: BBS10
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human BBS10 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX46-1 GGAATCAGTAATGGGTAAATA CDS Inquiry
V0126XX46-2 CAACCAGATTTAGTTAGTTAT CDS Inquiry
V0126XX46-3 AGCTGTAAGTTACCGAATATG CDS Inquiry
V0126XX46-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS10 shRNA Ad5 Particle (Silencing) targets a chaperonin-like protein required for BBSome assembly. Given that BBS10 mutations are a frequent cause of syndromic obesity, this knockdown tool is essential for studying protein folding in ciliary health. We ensure a high-performing gene-silencing solution via thorough QC validation, including high-precision titer verification and sequence integrity checks.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: BBS10
Full Name: Bardet-Biedl syndrome 10
Gene Symbol: C12orf58
Gene ID: 79738
RefSeq ID-1: NP_078961.3
RefSeq ID-2: NM_024685.3
Summary: BBS10 belongs to the BBS gene family and is associated with Bardet–Biedl syndrome type 10, a disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformations, and intellectual disability. Unlike most BBS proteins, BBS10 shows homology to type II chaperonins and is thought to function as a molecular chaperone that influences the folding or stability of ciliary and basal body proteins. Reduced expression of BBS10 disrupts ciliogenesis in preadipocytes, supporting its role in adipose tissue development.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.