Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human IFT172 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX114
Species: Human
Target Gene: IFT172
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human IFT172 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX114-1 CCAGTGGAAGAAGGCAATTTA CDS Inquiry
V0126XX114-2 GCAGACAATTGCTCCTTTGAA CDS Inquiry
V0126XX114-3 GAACATGGAGAACGGAGAGAT CDS Inquiry
V0126XX114-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human IFT172 shRNA Ad5 Particle (Silencing) focuses on the IFT172, a protein essential for ciliogenesis and Hedgehog signaling. Deficiency in IFT172 is associated with ciliopathy-related obesity and skeletal abnormalities. By reducing expression via specialized U6 or miR30 shRNA systems, this tool helps uncover the link between ciliary integrity and weight regulation. We provide a fully validated product through rigorous QC, ensuring sequence integrity and sterility for consistent performance.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: IFT172
Full Name: Intraflagellar transport 172
Gene Symbol: SLB; wim; RP71; BBS20; osm-1; NPHP17; SRTD10
Gene ID: 26160
RefSeq ID-1: NP_056477.1
RefSeq ID-2: NM_015662.3
Summary: IFT172 is a subunit of the IFT-B complex, which is required for the assembly of the primary cilium. Since the cilium is the cell's antenna for sensing appetite-regulating hormones, mutations in IFT172 lead to "ciliopathies." These often manifest as skeletal defects and syndromic obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.