Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ATF6 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX401
Species: Human
Target Gene: ATF6
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ATF6 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX401-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-7 AAV3 Lung; Liver; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-8 AAV3 Lung; Liver; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-9 AAV3 Lung; Liver; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-10 AAV4 CNS; Retina; Heart; Lung; Kidney ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-11 AAV4 CNS; Retina; Heart; Lung; Kidney GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-12 AAV4 CNS; Retina; Heart; Lung; Kidney CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX401-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX401-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX401-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ATF6 shRNA AAV Particle (Silencing) targets ATF6, a primary sensor of ER stress regulating protein folding and lipogenesis. By utilizing either high-potency U6-driven shRNA or physiologically refined miR30-based shRNA, researchers can investigate the cellular response to metabolic overload. Multiple AAV serotypes are available for selection. Every preparation is verified via thorough QC validation, including sequence integrity and sterility testing.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: ATF6
Full Name: Activating transcription factor 6
Gene Symbol: ACHM7; ATF6A; ATP6alpha
Gene ID: 22926
RefSeq ID-1: NP_031374.2
RefSeq ID-2: NM_007348.4
Summary: ATF6 encodes an endoplasmic reticulum–associated transcription factor that plays a central role in activating the unfolded protein response (UPR) under conditions of ER stress. Unlike conventional transcription factors, ATF6 is initially synthesized as a transmembrane protein localized to the ER membrane, where it serves as a stress sensor. Upon ER stress, ATF6 undergoes regulated proteolytic cleavage, releasing an active fragment that translocates to the nucleus and binds ER stress response elements (ERSEs) in the promoters of genes encoding ER chaperones. Persistent ER stress is a hallmark of obesity-related metabolic tissues, including adipose tissue and liver, linking ATF6 signaling to insulin resistance and dyslipidemia. Polymorphisms in ATF6 have shown variable associations with diabetes across populations, while other variants correlate with elevated plasma cholesterol. ATF6 has also been identified as a survival factor in quiescent squamous carcinoma cells and is being explored as a therapeutic target in cystic fibrosis.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.