Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ACLY shRNA AAV Particle (Silencing)

Cat. No.: V0126XX402
Species: Human
Target Gene: ACLY
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ACLY shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX402-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-7 AAV3 Lung; Liver; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-8 AAV3 Lung; Liver; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-9 AAV3 Lung; Liver; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-10 AAV4 CNS; Retina; Heart; Lung; Kidney GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-11 AAV4 CNS; Retina; Heart; Lung; Kidney CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-12 AAV4 CNS; Retina; Heart; Lung; Kidney CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCCTCAAGATACTATACATTT 3' UTR Inquiry
V0126XX402-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGTGAGAGCAATTCGAGATTA CDS Inquiry
V0126XX402-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCTATGACTATGCCAAGACTA CDS Inquiry
V0126XX402-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ACLY shRNA AAV Particle (Silencing) targets ACLY, the link between glucose metabolism and de novo lipogenesis. Engineered with both U6 and miR30-based shRNA frameworks, this tool allows for the exploration of fatty acid and cholesterol synthesis. Our system provides multiple AAV serotypes for tissue-specific tropism, supported by total quality control screening for functional titer, sequence verification, and the absence of pathogens.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: ACLY
Full Name: ATP citrate lyase
Gene Symbol: ACL; ATPCL; CLATP
Gene ID: 47
RefSeq ID-1: NP_001087.2
RefSeq ID-2: NM_001096.2
Summary: ACLY encodes ATP citrate lyase, a cytosolic enzyme that generates acetyl-CoA from citrate and coenzyme A through an ATP-dependent reaction. The enzyme functions as a tetramer composed of four similar subunits and produces acetyl-CoA and oxaloacetate while hydrolyzing ATP to ADP and phosphate. Acetyl-CoA derived from ACLY serves as a key precursor for lipid and cholesterol biosynthesis, pathways that are frequently upregulated in obesity and metabolic syndrome. Increased ACLY activity supports de novo lipogenesis in adipose tissue and liver, contributing to fat accumulation. In neuronal tissues, ACLY may also participate in acetylcholine synthesis. Multiple transcript variants encoding distinct isoforms have been described.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.