Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human THBS1 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX153
Species:
Human
Target Gene:
THBS1
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX153-1 | AGACATCTTCCAAGCATATAA | 3' UTR | Inquiry |
| V0126XX153-2 | GTAGGTTATGATGAGTTTAAT | CDS | Inquiry |
| V0126XX153-3 | CGTGACTGTAAGATTGTAAAT | 3' UTR | Inquiry |
| V0126XX153-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human THBS1 shRNA Ad5 Particle (Silencing) enables the targeted inhibition of thrombospondin-1, a glycoprotein often elevated in the adipose tissue of obese individuals that promotes inflammation and insulin resistance. Utilizing an advanced RNAi platform with either U6 or miR30 shRNA architectures, this tool allows for the investigation of THBS1 as a link between metabolic stress and vascular dysfunction. Each preparation is verified via thorough QC validation, including sequence integrity and sterility testing, to ensure optimal reliability for your metabolic assays.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
THBS1
Full Name:
Thrombospondin 1
Gene Symbol:
TSP; THBS; TSP1; TSP-1; THBS-1
Gene ID:
7057
RefSeq ID-1:
NP_003237.2
RefSeq ID-2:
NM_003246.3
Summary:
THBS1 (Thrombospondin-1) is an adhesive glycoprotein that mediates cell-to-matrix interactions. In the context of obesity, THBS1 is a known marker of adipose tissue inflammation. It is upregulated in the visceral fat of obese individuals, where it contributes to insulin resistance and alters the structural integrity of the extracellular matrix during fat mass expansion.
Related Products
-
AdipoUpX™ Human MC2R Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human NPY shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human HSD11B1 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human DYRK1B shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human SLC6A14 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human ARL6 shRNA Ad5 Particle (Silencing)